Reactivity of Human and Porcine Natural Interferon-a Producing Cells to Immunostimulatory DNA

نویسنده

  • Mattias Magnusson
چکیده

Magnusson, M. 2003. Reactivity of human and porcine natural interferon-a producing cells to immunostimulatory DNA. Doctor’s dissertation. ISSN 1401-6257, ISBN 91-576-6389-0 The interferon-a (IFN-a) inducing capacity of various forms of immunostimulatory DNA and the identity of the IFN-a producing cells (IPC) were studied in human and porcine leukocytes. The DNA vaccine vector pcDNA3 induced production of IFN-a in porcine peripheral blood mononuclear cells (PBMC), but only if used with the transfecting agent lipofectin. Unmethylated CpG dinucleotides in the plasmid were necessary for induction of IFN-a, but pcDNA3 retained this ability after mutation of the CpG-motifs (5’AACGTT 3’) in the ampicillin resistance gene. Lipofection and presence of an unmethylated CpG were also prerequisites for the ability of the double stranded (ds) phosphodiester oligodeoxyribonucleotide (ODN) H (5’ TTTTCAATTCGAAGATGAAT 3’) to activate production of IFN-a in human and porcine PBMC. Human, but not porcine, PBMC could still produce high levels of IFN-a in response to certain single stranded (ss) ODNs, devoid of unmethylated CpG dinucleotides. This indicates that there are species differences in the recognition of immunostimulatory DNA and that eukaryotic DNA sometimes can be interferogenic. Certain CpG-containing ODNs with flanking poly-G sequences were very potent inducers of IFN-a production in the absence of lipofectin, both as phosphorothioate/ phosphodiester chimeric ODNs or as phosphodiester ODNs. Addition of poly-G sequences to the phosphodiester ODN H clearly enhanced its activity, but did not replace the need for lipofectin. The natural IFN-a producing cells (NIPC), also termed plasmacytoid dendritic cells (PDC), were the only cells among human or porcine PBMC that produced IFN-a in response to immunostimulatory DNA. The human NIPC/PDC also produce IFN-a in response to apoptotic cells in combination with autoantibodies from patients with systemic lupus erythematosus (SLE). This activation was dependent on Fcg-receptor type II (FcgRII), and the NIPC/PDC were shown to express FcgRIIa, but not the FcgRIIb/c isoforms. The FcgRIIa may also be inhibitory, because aggregated IgG that binds FcgR had a general inhibitory effect on IFN-a production induced by immunostimulatory DNA or herpes simplex virus. Elucidation of the mechanisms whereby NIPC/PDC are activated may result in more efficient vaccine adjuvants and also provide new targets aiming at inhibition of the pathologic activation of NIPC/PDC in autoimmune diseases.

برای دانلود رایگان متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

Silencing of natural interferon producing cell activation by porcine circovirus type 2 DNA.

Porcine circovirus type 2 (PCV2) infection of natural interferon producing cells (NIPCs) impairs the induction of interferon (IFN)-alpha and tumour necrosis factor (TNF)-alpha by cytosine-phosphorothioate-guanine (CpG) oligodeoxynucleotides (ODNs), thereby preventing both their autocrine maturation and the paracrine maturation of myeloid dendritic cells (DCs). The present study shows that the P...

متن کامل

Inducible Expression of Human Gamma Interferon

Background:The premature termination of high producer clones, which will be killed due to cell proliferation and proteins production antagonism, is one of the basic drawback in recombinant proteins technology. Furtheremore, it is supposed some toxic proteins like interferon which we intended to clone and express, inhibit host cells’ proliferation. So, it is necessary to tightly control IFN-γ pr...

متن کامل

Cloning and Expression of Human Gamma-Interferon cDNA in E. coli

Prior to the production of human gamma interferon using recombinant DNA technology, it had been producedmainly upon mitogenic induction of lymphocytes in very low amounts, which evidently hamperedits characterization and its medical applications. The recombinant gamma interferons produced in largerquantities in prokaryotic systems retain their biological activities, and can be...

متن کامل

Application of Rapid and Sensitive Real Time PCR Technique in Detection of DNA Impurities in Recombinant Interferon

 Background & Objective: Interferon belongs to a family of cytokines, which has the most important role in the innate immune response to virus infections. While producing recombinant interferon in biological host, some pieces of host nucleic acids remain in product. Because of limitations in previous techniques for detection of these impurities, the objective of this study is to use rapid ...

متن کامل

تولید آنتی بادی مونوکلونال علیه آنتی زن های سطح اسپرم انسان

Introduction: As monoclonal antibodies are potential tools for characterization of soluble or cellular surface antigens, use of these proteins has always been considered in infertility and reproduction research. Therefore, in this study, monoclonal antibodies against human sperm surface antigens were produced. Material and Methods: To produce specific clones against human sperm surface antig...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

عنوان ژورنال:

دوره   شماره 

صفحات  -

تاریخ انتشار 2003